Required External Data
All VRS implementations will require external data regarding sequences and sequence metadata. The choices of data sources and access methods are left to implementations. This section provides guidance about how to implement required data and helps implementers estimate effort. This section is descriptive only: it is not intended to impose requirements on interface to, or sources of, external data. For clarity and completeness, this section also describes the contexts in which external data are used.
Contexts
Conversion from other variant formats When converting from other variation formats, implementations MUST translate primary database accessions or identifiers (e.g.,
NM_000551.3orrefseq:NM_000551.3) to a GA4GH VRS sequence identifier (ga4gh:SQ.v_QTc1p-MUYdgrRv4LMT6ByXIOsdw3C_)Conversion to other variant formats When converting to other variation formats, implementations SHOULD translate GA4GH VR sequence identifier (
ga4gh:SQ.v_QTc1p-MUYdgrRv4LMT6ByXIOsdw3C_) to primary database identifiers (refseq:NM_000551.3) that will be more readily recognized by users.Normalization During Normalization, implementations will need access to sequence length and sequence contexts.
Data Services
The following tables summarizes data required in the above contexts:
Data Service |
Description |
Contexts |
|---|---|---|
sequence |
For a given sequence identifier and range, return the corresponding subsequence. |
normalization |
sequence length |
For a given sequence identifier, return the length of the sequence |
normalization |
identifier translation |
For a given sequence identifier and target namespace, return all identifiers in the target namespace that are equivelent to the given identifier. |
Conversion to/from other formats |
Note
Construction of the GA4GH computed identifier for a sequence is described in Computed Identifiers.
Suggested Implementation
In order to maximize portability and to insulate implementations from decisions about external data sources, implementers should consider writing an abstract data proxy interface to define a service, and then implement this interface for each data backend to be supported. The data proxy interface defines three methods:
get_sequence(identifier, start, end): Given a sequence identifier and start and end coordinates, return the corresponding sequence segment.get_metadata(identifier): Given a sequence identifier, return a dictionary of length, alphabet, and known aliases.translate_sequence_identifier(identifier, namespace): Given a sequence identifier, return all aliases in the specified namespace. Zero or more aliases may be returned.
The vrs-python: GA4GH VRS Python Implementation DataProxy class provides an example of this design pattern and sample replies. GA4GH VRS Python Implementation implements the DataProxy interface using a local SeqRepo instance backend and using a SeqRepo REST Service backend. A GA4GH refget implementation has been started, but is pending interface changes to support lookup using primary database accessions.
Examples
The following examples are taken from VRS Python Notebooks:
from ga4gh.vrs.dataproxy import SeqRepoRESTDataProxy
seqrepo_rest_service_url = "http://localhost:5000/seqrepo"
dp = SeqRepoRESTDataProxy(base_url=seqrepo_rest_service_url)
def get_sequence(identifier, start=None, end=None):
"""returns sequence for given identifier, optionally limited
to inter-residue <start, end> interval"""
return dp.get_sequence(identifier, start, end)
def get_sequence_length(identifier):
"""return length of given sequence identifier"""
return dp.get_metadata(identifier)["length"]
def translate_sequence_identifier(identifier, namespace):
"""return for given identifier, return *list* of equivalent identifiers in given namespace"""
return dp.translate_sequence_identifier(identifier, namespace)
get_sequence_length("ga4gh:SQ.IIB53T8CNeJJdUqzn9V_JnRtQadwWCbl")
58617616
start, end = 44908821-25, 44908822+25
get_sequence("ga4gh:SQ.IIB53T8CNeJJdUqzn9V_JnRtQadwWCbl", start, end)
'CCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGC'
translate_sequence_identifier("GRCh38:19", "ga4gh")
['ga4gh:SQ.IIB53T8CNeJJdUqzn9V_JnRtQadwWCbl']
translate_sequence_identifier("ga4gh:SQ.IIB53T8CNeJJdUqzn9V_JnRtQadwWCbl", "GRCh38")
['GRCh38:19', 'GRCh38:chr19']